Midterm (Version A) Solutions Fall 2011

PwnHero BME501/CPS501 Midterm Version A, Nov 4, 2011. Ryerson University 1. (2 marks) You are the finisher and you need to arrange these 8 sequenced segments of DNA to build the largest possible contigs with the minimum number of gaps. Assume that an overlap of 5 bases is significant. Draw the contigs showing the overlapping segments. GGCGTCGGCGAGATCATCTGTGACAATC GAAGGTACCTCAAGGTATTG GAGTGTGTCGTCGTTGGCGT GTATGAGGAGAGTATGAGTG ATCTGTGACAATCCATCTTG GAGTGTGTCGT GGCGTCGGCGAGATCATCTG TATTGTATAATCCCCATCCC GGCGTCGGCGAGATCATCTGTGACAATC GAGTGTGTCGTCGTTGGCGT ATCTGTGACAATCCATCTTG GTATGAGGAGAGTATGAGTG GGCGTCGGCGAGATCATCTG GAGTGTGTCGT TATTGTATAATCCCCATCCC GAAGGTACCTCAAGGTATTG 2. (2 marks) Assume that (1) a primer for PCR is 5 bases long, and (2) that the contigs you generated in question 1 are close enough in the genome that you can use PCR to make fragment(s) that will close gaps, and (3) that the contigs line up longest to shortest going left to right in the genome. What are the sequences of the primers that you would use? We want to generate a fragment that looks like TCTTG.............GAAGG, so that we can link up the two contigs. The left primer therefore would be TCTTG, and the right primer would be the reverse complement of GAAGG, so CCTTC. 3. (1 mark) Provide evidence (other than BLAST) regarding whether the first sequence in Question 1 is “coding”. Putting the first sequence GGCGTCGGCGAGATCATCTGTGACAATC into Testcode program on geneticsplace, we get the result 1.199 – probably coding. 4. (3 marks) (a) What is the GC content of the first fragment (sequence) in question 1? (b) What is the GC skew? (c) Would either of these values be different if you did the calculation on the complementary strand? Explain and show your work for each answer. (You can use an online application to confirm your answer, but you must show a manual calculation.) PwnHero.com